Other Resources

For more information about our other resources, please check out our information page.

For explanations of fields, please checkout out our field definitions.

Name	VDRC Id	Library	Sub-Category	Genotype	Comment	Construct Id	Publication	Provider Scientist	Provider Organization	Gene Symbol	Synonyms	Sequence	Comment	Gene Name	Keywords	Price (net)
314068	314068	JB-STOCK	tagged construct	w; ; 3xFLAG/V5/Precission/GFP-HP1c	Endogenously tagged HP1c; aka: LB4-f212.	314068	Baumgartner et al. , eLife (2022)	Julius Brennecke	Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA)	HP1c	3x FLAG GFP HP1 HP1C HP1c Heterochromatin Protein 1c Heterochromatin protein 1c Hp1c Precission V5 heterochromatin protein 1c hp1c tag		Endogenously tagged HP1c; aka: LB4-f212.	Heterochromatin Protein 1c	tag FLAG Precission 3x GFP V5	Sign In to show prices
314069	314069	JB-STOCK	tagged construct	w; peggless>TurboID-linker-vhhGFP-3xHA-NLS[attP40]/CyO	TurboID biotin ligase fused to GFP nanobody, expressed from eggless regulatory elements. Aka: CY59.	314069	Baumgartner et al. , eLife (2022)	Julius Brennecke	Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA)		GFP GFP nanobody HA NLS TurboID biotin eggless fusion construct ligase nanobody synthetic construct vhh		TurboID biotin ligase fused to GFP nanobody, expressed from eggless regulatory elements. Aka: CY59.		ligase HA fusion construct TurboID NLS nanobody GFP eggless vhh synthetic construct GFP nanobody biotin	Sign In to show prices
310601	310601	FB-STOCK	tagged construct	w*; me31B[KI.mTomato]	The mTomato sequence was inserted via Crispr/Cas9 in the me31B locus, at the C-terminus of the me31B coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. This line can be used as a P-body marker, but not to assess granule material properties. It contains a 12 aa deletion at the end of Me31B coding sequence and the mTomato tag may affect granule material properties.	310601	Formicola et al., eLife (2021)	Florence Besse	Institute de Biologie Valrose (iBV) (http://ibv.unice.fr/)	me31B	C-terminal mTomato tag DDX6 Dhh1p/Me31b DmRH3 ME31B Mat31B Maternal expression at 31B Me31B Me31b P-body marker knock-in l(2)k06607 mTomato maternal expression at 31B me31B me31b	see publication	The mTomato sequence was inserted via Crispr/Cas9 in the me31B locus, at the C-terminus of the me31B coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. This line can be used as a P-body marker, but not to assess granule material properties. It contains a 12 aa deletion at the end of Me31B coding sequence and the mTomato tag may affect granule material properties.	maternal expression at 31B	knock-in C-terminal mTomato tag P-body marker mTomato	Sign In to show prices
310602	310602	FB-STOCK	tagged construct	w*; ; rin[KI.mCherry]	The mCherry sequence was inserted via Crispr/Cas9 in the rin locus, at the N-terminus of the rin coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mCherry. Rin is the Drosophila ortholog of the G3BP1; it is Stress Granule marker positive.	310602	Pushpalatha et al., Nat com (2022)	Florence Besse	Institute de Biologie Valrose (iBV) (http://ibv.unice.fr/)	rin	N-terminal mCherry tag Next to squid Nts RIN Rasputin Rin Stress Granule marker cg9412 knock-in mCherry rasp rasputin rin	see publication (Formicola et al., 2021; doi: 10.7554/eLife.65742.)	The mCherry sequence was inserted via Crispr/Cas9 in the rin locus, at the N-terminus of the rin coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mCherry. Rin is the Drosophila ortholog of the G3BP1; it is Stress Granule marker positive.	rasputin	Stress Granule marker knock-in N-terminal mCherry tag mCherry	Sign In to show prices
310603	310603	FB-STOCK	tagged construct	w*; ; Patr-1[KI.mTomato]	The mTomato sequence was inserted via Crispr/Cas9 in the Patr-1 locus, at the C-terminus of the Patr-1 coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. Patr-1 is the Drosophila ortholog of PATL1; it can be used as a P-body marker.	310603	Pushpalatha et al., Nat com (2022)	Florence Besse	Institute de Biologie Valrose (iBV) (http://ibv.unice.fr/)	Patr-1	BcDNA:LD27979 C-terminal mTomato tag HPat HPat1 Hpat LD27979 P-body marker Part-1 Patr-1 Protein associated with topo II related - 1 anon-WO0118547.282 hpat knock-in l(3)06442 lethal (3) 06442 mTomato patr-1	see publication (Formicola et al., 2021; doi: 10.7554/eLife.65742.)	The mTomato sequence was inserted via Crispr/Cas9 in the Patr-1 locus, at the C-terminus of the Patr-1 coding sequence, using the strategy described in Kina et al., 2019 (DOI: 10.1111/dgd.12607). No selection marker was used. Phenotype: white eyes, larvae mTomato positive. Patr-1 is the Drosophila ortholog of PATL1; it can be used as a P-body marker.	Protein associated with topo II related - 1	C-terminal mTomato tag P-body marker knock-in mTomato	Sign In to show prices
311200	311200	IR-STOCK	modified LexA with tdTomato and LOV	w; +; UAS-eLOVnls-tdTomato-mLexAp65 su(Hw)attP1	UAS expression of LOV-LexA, a modified LexA that mediates light-dependent transcription of transgenes under LexAop sequences	311200	Ribeiro, et al, 2021 (preprint)					empty	UAS expression of LOV-LexA, a modified LexA that mediates light-dependent transcription of transgenes under LexAop sequences			Sign In to show prices
312017	312017	AS-STOCK		w;+;Clktag		312017	Meireles-Filho et al., 2014				Clktag	empty			Clktag	Sign In to show prices
312018	312018	AS-STOCK		w;If/CyO;Clktag		312018	Meireles-Filho et al., 2014				Clktag	empty			Clktag	Sign In to show prices
312041	312041	AS-STOCK		w; ; Cyctag;		312041	Meireles-Filho et al., 2014				Cyctag	empty			Cyctag	Sign In to show prices
312042	312042	AS-STOCK		w/Yhh; If/Cyo; cyctag;		312042	Meireles-Filho et al., 2014				TM3Ser cyctag w; If/Cyo; cyctag/TM3Ser;	empty			TM3Ser cyctag w; If/Cyo; cyctag/TM3Ser;	Sign In to show prices
312106	312106	AS-STOCK		w; +; Ubx-tag;		312106	Shlyueva et al., PLOS ONE 2016 (PMID: 27575958)					empty				Sign In to show prices
312158	312158	AS-STOCK	gene knockout	w[*];; CG11247[indel1]/TM3,Sb;	A single nucleotide deletion in the first exon of CG11247. Created via gRNA + Cas9 injection.	312158	Hofbauer et al., Molecular Cell (2024)	Alex Stark	Institute of Molecular Pathology (IMP)	CG11247	CG11247-knockout	GATTACGTGCAACCGCAG-TTAAGAAGTCTGCCCGAAAGGGCGAACCGGTG	A single nucleotide deletion in the first exon of CG11247. Created via gRNA + Cas9 injection.		CG11247-knockout	Sign In to show prices