Heidelberg CFD CRISPR Library

For more information about our Heidelberg CFD CRISPR Library, please check out our information page.

For explanations of fields, please checkout out our field definitions.

Name	VDRC Id	Library	Sub-Category	Genotype	Comment	Construct Id	Publication	Provider Scientist	Provider Organization	Gene Symbol	Synonyms	HD_CFD ID	HDtools ID	Target sgRNA1	Target sgRNA2	Insertion Site	Vector	Comment	Gene Name	Keywords	Price (net)
342990	342990	HD-CFD-Cas9	sgRNA			342990	Port et al., eLife, 2096				SiaT cfd hd hd_cfd heidelberg heidelberg_cfd	HD_CFD02629		GATAATGAGGCATGAAAGGA	TCCATGACCAGGCAGGTCGA	attP40	pCFD6			hd heidelberg_cfd heidelberg hd_cfd cfd	Sign In to show prices
342991	342991	HD-CFD-Cas9	sgRNA			342991	Port et al., eLife, 2097				Sem1 cfd hd hd_cfd heidelberg heidelberg_cfd	HD_CFD02652		GTCTGCCCCAGATAAGGAAA	CGAAGACTTGGGTCTCCTGG	attP40	pCFD6			heidelberg_cfd hd_cfd heidelberg cfd hd	Sign In to show prices
340008	340008	HDtools-Cas9	Cas9	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=UAS-FRT-mEGFP-FRT-uM-Cas9}attP40	for induction by FLP-out; medium Cas9 levels	340008					UAS-FRT-mEGFP-FRT-uM-Cas9		HD_CFDtools009			attP40	pBIC-UASC	for induction by FLP-out; medium Cas9 levels			Sign In to show prices
343000	343000	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0001}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0086348.	343000	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	se	CRISPR Cas12a GSTO1 GSTO4 HD12aCFD0001 cg6781 dmgsto1 knockout se sepia sgRNA						343000	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0086348.	sepia	CRISPR sgRNA knockout Cas12a	Sign In to show prices
343001	343001	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0002}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0259956.	343001	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	Sfp24C1	CRISPR Cas12a HD12aCFD0002 Seminal fluid protein 24C1 Sfp24C1 knockout sgRNA						343001	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0259956.	Seminal fluid protein 24C1	sgRNA Cas12a knockout CRISPR	Sign In to show prices
343002	343002	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0003}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0004034.	343002	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	y	CRISPR Cas12a EG:125H10.2 HD12aCFD0003 T6 Y knockout sgRNA y yellow						343002	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0004034.	yellow	knockout Cas12a sgRNA CRISPR	Sign In to show prices
343003	343003	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0004}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0003444.	343003	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	smo	CRISPR Cas12a HD12aCFD0004 SMO Smo Smoothene Smoothened dSmo knockout sgRNA smo smooth smoothened						343003	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0003444.	smoothened	knockout sgRNA CRISPR Cas12a	Sign In to show prices
343004	343004	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0005}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0284084.	343004	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	wg	Br Bristled CRISPR Cas12a Complementation group I DWint-1 DWnt-1 Dint-1 Dm Wg Dm-1 Gla Glazed HD12aCFD0005 I Sp Sternopleural WG WNT Wg Wingless Wnt Wnt-1 Wnt/Wg Wnt1 dWnt fg fl						343004	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0284084.	wingless	knockout sgRNA CRISPR Cas12a	Sign In to show prices
343005	343005	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0006}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0004198.	343005	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	ct	BcDNA:GH10590 CRISPR CT CUT Cas12a Ct Cut HD12aCFD0006 ct cut kf kinked-femur knockout l(1)7Ba l(1)7Bb l(1)VE614 sgRNA						343005	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0004198.	cut	CRISPR sgRNA knockout Cas12a	Sign In to show prices
343006	343006	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0007}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0036141.	343006	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	wls	CRISPR Cas12a Evenness Interrupted Evenness interrupted Evi Evi/Wls HD12aCFD0007 Sprinter Srt Wls Wls/Evi Wntless evenness interrupted evi knockout sgRNA sprinter srt wls wls/evi wntless						343006	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0036141.	wntless	knockout sgRNA Cas12a CRISPR	Sign In to show prices
343007	343007	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0008}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0016970.	343007	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	l(2)k10201	B CG8803 CRISPR Cas12a HD12aCFD0008 knockout l(2)k10201 lethal (2) k10201 sgRNA						343007	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0016970.	lethal (2) k10201	Cas12a sgRNA CRISPR knockout	Sign In to show prices
343008	343008	HD-CFD-12a	sgRNA	P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=HD12aCFD0009}attP40/CyO, P{GFP, w[-]}	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0264751.	343008	Port et al., biorxiv (2024)	Fillip Port and Michael Boutros	DKFZ, Heidelberg	Vti1b	CG31232 CG7682 CRISPR Cas12a EP(3)1037 HD12aCFD0009 knockout sgRNA						343008	Expression of multiplexed sgRNAs from a U6:3 promoter targeting gene FBgn0264751.	Vesicle transport through interaction with t-SNAREs 1b	Cas12a CRISPR knockout sgRNA	Sign In to show prices