330481
Sign In to show prices
SKU
SHRNA-330481
| VDRC Id | 330481 |
|---|---|
| Library | shRNA |
| Sub-Category | shRNA Stocks |
| Status | available |
| Construct Id | 330481 |
| CG Number (r6.01) | CG7361 |
| FlyBase gene number | FBgn0021906 FBgn0025542 FBgn0031352 |
| Synonyms | H Noble Not out of the blue RFeSP RIESKE IRON-SULFUR PROTEIN RISP RfeSP Rieske Iron-Sulfur Protein Rieske iron sulfur protein Rieske iron sulphur protein Rieske iron- sulfur protein of complex III Rieske iron-sulfur protei |
| Inserted Chromosome | 2 |
| Viability | viable |
| Insertion Site | attP40 |
| 21bp Sequence (sense) | CGAGATCAAGCTGTCCGACAT |
| 21bp Sequence (antisense) | ATGTCGGACAGCTTGATCTCG |
| Sequence | ctagcagtCGAGATCAAGCTGTCCGACATtagttatattcaagcataATGTCGGACAGCTTGATCTCGgcg |