330015
Sign In to show prices
SKU
SHRNA-330015
| VDRC Id | 330015 |
|---|---|
| Library | shRNA |
| Sub-Category | shRNA Stocks |
| Status | available |
| Construct Id | 330015 |
| CG Number (r6.01) | CG11098 |
| FlyBase gene number | FBgn0031842 FBgn0260099 FBgn0286898 |
| Synonyms | 2L3443 TANGO1 Tango1 Transport and Golgi organization 1 tango1 transport and Golgi organisation 1 |
| Inserted Chromosome | 2 |
| Viability | viable |
| Insertion Site | attP40 |
| 21bp Sequence (sense) | TGGATTCGCAGTCCAACGAAA |
| 21bp Sequence (antisense) | TTTCGTTGGACTGCGAATCCA |
| Sequence | ctagcagtTGGATTCGCAGTCCAACGAAAtagttatattcaagcataTTTCGTTGGACTGCGAATCCAgcg |