313985

Sign In to show prices
SKU
JB-STOCK-313985
More Information
VDRC Id 313985
Library JB-STOCK
Sub-Category tagged endogenous genes
Status available
Comment Guide: CAAAGTCCAGCACTCTCATC, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP tag;
Construct Id 313985
Genotype ; ; FLAG_V5_GFP_Nxf2 m12-1;
Synonyms nuclear RNA export factor 2
Sequence empty
Viability unknown
Publication Batki, Schnabl et al, Nat Struct Mol Biol. 2019
Provider Organization Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA)