313984
Sign In to show prices
SKU
JB-STOCK-313984
| VDRC Id | 313984 |
|---|---|
| Library | JB-STOCK |
| Sub-Category | tagged endogenous genes |
| Status | temporarily unavailable |
| Comment | Guide: CAAAGTCCAGCACTCTCATC, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP tag; |
| Construct Id | 313984 |
| Genotype | ; ; FLAG_V5_GFP_Nxf2 m11-1; |
| Synonyms | nuclear RNA export factor 2 |
| Sequence | empty |
| Viability | unknown |
| Publication | Batki, Schnabl et al, Nat Struct Mol Biol. 2019 |
| Provider Organization | Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA) |