313982
Sign In to show prices
SKU
JB-STOCK-313982
| VDRC Id | 313982 |
|---|---|
| Library | JB-STOCK |
| Sub-Category | tagged endogenous genes |
| Status | available |
| Comment | Guide: ACTTTGACCTCTAGCTTCAT, Donor: N-terminal 3xFLAG_V5_Precission_loxP_GFP tag; |
| Construct Id | 313982 |
| Genotype | ; FLAG_V5_GFP_Panx m8-1; ; |
| Synonyms | Panoramix, Silencio |
| Sequence | empty |
| Viability | unknown |
| Publication | Batki, Schnabl et al, Nat Struct Mol Biol. 2019 |
| Provider Organization | Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA) |