313695
Sign In to show prices
SKU
JB-STOCK-313695
| VDRC Id | 313695 |
|---|---|
| Library | JB-STOCK |
| Sub-Category | shmiR line |
| Status | available |
| Comment | attP2 landing site, 1st zuc_shmiR sequence is identical to GL00111, 2nd nibbler_shmiR sequence is identical to nbr_sh2, 1st top primer(zucchini): CTAGCAGTTTGTTGTGCATCAAGTTCGTGTAGTTATATTCAAGCATACACGAACTTGATGCACAACAAGCG, 2nd top primer(nibbler): ccggtAGTATGGTCAGTGATCTCAGTGTATAGTTATATTCAAGCATATACACTGAGATCACTGACCATGCgcatg |
| Construct Id | 313695 |
| Genotype | w; If/CyO; pW20>zuc_sh+nbr_sh[attP2]/TM3,Ser; |
| Synonyms | zucchini, nibbler |
| Sequence | empty |
| Viability | unknown |
| Publication | Hayashi & Schnabl, Nature, 2016 |
| Provider Organization | Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA) |