313350
Sign In to show prices
SKU
JB-STOCK-313350
| VDRC Id | 313350 |
|---|---|
| Library | JB-STOCK |
| Sub-Category | Tagged construct |
| Status | available |
| Comment | BAC construct containg the CG31755 locus with N-terminal GFP-tag; tag inserted at an ATG that was the predicted start codon in a previous FlyBase version (TCAACTGAGGCGATGTACAACGGCG) |
| Construct Id | 313350 |
| Genotype | w; GFP_CG31755 [attP40]/CyO; ; |
| Synonyms | SoYb |
| Sequence | empty |
| Viability | unknown |
| Provider Organization | Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA) |