313196

Sign In to show prices
SKU
JB-STOCK-313196
More Information
VDRC Id 313196
Library JB-STOCK
Sub-Category RNAi lines
Status available
Comment in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo sequence: CTAGCAGTCCGGATGATGCTGGACGATCATAGTTATATTCAAGCATATGATCGTCCAGCATCATCCGGGCG
Construct Id 313196
Genotype w; ; pGLKD>cuff_sh1[attP2]/TM3,Sb;
Synonyms cuff
Sequence empty
Viability unknown
Publication Mohn et al., 2014; Andersen et al., Nature 2017
Provider Organization Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA)