313196
Sign In to show prices
SKU
JB-STOCK-313196
| VDRC Id | 313196 |
|---|---|
| Library | JB-STOCK |
| Sub-Category | RNAi lines |
| Status | available |
| Comment | in Dominik Handler's germline knockdown vector (plasmid JB227); sh-oligo sequence: CTAGCAGTCCGGATGATGCTGGACGATCATAGTTATATTCAAGCATATGATCGTCCAGCATCATCCGGGCG |
| Construct Id | 313196 |
| Genotype | w; ; pGLKD>cuff_sh1[attP2]/TM3,Sb; |
| Synonyms | cuff |
| Sequence | empty |
| Viability | unknown |
| Publication | Mohn et al., 2014; Andersen et al., Nature 2017 |
| Provider Organization | Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA) |