311471
Sign In to show prices
SKU
PP-STOCK-311471
| VDRC Id | 311471 |
|---|---|
| Library | PP-STOCK |
| Sub-Category | sgRNA |
| Status | available |
| Comment | The constitutive 'U6:2' (snRNA:U6:96Ab) promoter drives expression of a single Tag:MS2-tagged sgRNA that forms one component of the three-component flySAM (synergistic activation mediator) system, which is used to produce effective transcriptional activation of a gene of interest. In this case, the sgRNA sequence (TCTCCGTGGCAGACGTGACC) targets sequence 375bp upstream of Sdb. |
| Construct Id | 311471 |
| Genotype | w[*]; Sp/CyO; P{U6:2-Sdb.flySAM2.0}attP2 |
| Gene Symbol | Sdb |
| Gene Name | SAXO downstream of blistered |
| Synonyms | CG13017 CG8381 Microtubules SAXO downstream of blistered Sdb |
| Keywords | Microtubules |
| Inserted Chromosome | 1;2;3 |
| Sequence | TCTCCGTGGCAGACGTGACC |
| Viability | viable |
| Publication | Sun et al., Cell Rep (2021) |
| Provider Scientist | Jose C. Pastor-Pareja |
| Provider Organization | Institute of Neurosciences (CSIC-UMH), Alicante, Spain |